Nová nepříjemná zjištění v souvislosti s mRNA injekcí od Pfizeru. Nová studie zjistila, že mRNA se přepisuje do lidské DNA. Jaké to může mít důsledky?

DNA sekvence uváděná v článku je skutečně sekvence Pfizeru.

Podobnost s gp130 je velmi nepříjemná, neb gp130 je zapojen v signalizačních kaskádách vedoucích k mitogenezi, a od mitogeneze je k rakovinovému nádoru jen krůček.

Mitogenem je peptid nebo malý protein , který indukuje buňky k zahájení buněčného dělení : mitózy . Mitogeneze je indukce (spouštění) mitózy, obvykle prostřednictvím mitogenu. Mechanismus účinku mitogenu spočívá v tom, že spouští cesty přenosu signálu zahrnující mitogenem aktivovanou proteinovou kinázu (MAPK), což vede k mitóze. Mitogen – wiki/Mitogen

Pokud se to skutečně i integruje do genomu, tak to je opravdu průšvih, neb fenomén “integračního místa” je velká věc.

Nelze predikovat, kam se to zaintegruje, a rovněž nikdo neví, kolikrát se to zaintegruje – asi se nebude jednat o jednu integraci, ale spíše o náhodnou a vícečetnou integraci, tak jak to bývá po infekci retroviry.

Vyšla nová studie: Intracelulární reverzní transkripce mRNA vakcíny BNT162b2 od společnosti Pfizer BioNTech COVID-19 in vitro v buněčné linii lidských jater.

Článek říká, že laboratorní studie ukazují, že se mRNA vakcína skutečně integruje do lidské buněčné DNA. To znamená, že injekce vakcíny společnosti Pfizer podaná, byť jen jednou, trvale změní DNA postižených buněk.

Nemělo se to stát

Více než rok nám naši důvěryhodní „zdravotničtí experti a ověřovatelé faktů” neustále tvrdili opak:

Bombastický článek z časopisu Current Issues of Molecular Biology však ukazuje pravý opak.

Článek ukazuje, že in vitro, za použití linie lidských jaterních buněk, vakcína Pfizer mRNA využívá přirozený enzym reverzní transkriptázu zvanou LINE-1 a genetický kód vakcíny je zpětně přepsán do DNA.

Vysvětluje také, že mRNA vakcína skutečně putuje do jater jako do jednoho z preferovaných míst (dalšími místy, jak jsme slyšeli, jsou vaječníky a další).

Co to znamená? Za normálních okolností naše buňky postupují opačně: buněčné jádro, kde se nachází DNA, vyjadřuje určitý kód DNA na základě podmínek v buňce a produkuje přirozenou, lidskou messenger RNA. Tato messenger RNA putuje ven z jádra, kde se exprimuje do proteinů potřebných pro stavbu buňky. Takto rostoucí organismy vyjadřují různé genetické programy pro růst svalových buněk nebo mozkových buněk atd.

Tento proces se nazývá „transkripce”.

Centrální dogma molekulární biologie po mnoho let tvrdilo, že „zpětná transkripce” – přesun genetického kódu z RNA zpět do posvátného buněčného jádra a překódování DNA – je nemožná. Nakonec si vědci uvědomili, že to za různých podmínek možné je. Například virus HIV RNA je toho schopen a přeprogramuje naši DNA tak, aby vytvářela její kopie. HIV je virus, který způsobuje AIDS.

K provedení reverzní transkripce jsou zapotřebí enzymy zvané „reverzní transkriptázy”. Jeden z nich se nazývá LINE-1.

Podle studie zřejmě mRNA vakcína společnosti Pfizer způsobuje, že buňky tento enzym LINE-1 produkují.

Poté, co zaznamenali nárůst reverzní transkriptázy LINE-1, testovali změny DNA, aby se ujistili, že místo ní nezachycují RNA.

Genetický kód, který zachytili, je:

CGAGGTGGCCAAGAATCTGAACGAGA GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT TCGACGAGGACGATTCTGAGCCCGTGCTGA AGGGCGTGAAACTGCACTACACATGATGAC TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Chce na něm někdo spustit BLAST?

Zjednodušeně

Jak jsem vysvětlil v odpovědi na dotaz:

Vakcína Pfizer mRNA mění náš genetický kód, který určuje fungování našich organismů a který jste zdědili po mamince a tatínkovi. Nyní byla vaše DNA změněna oproti tomu, co vám předali máma a táta, přidáním malé záhadné „úpravy” od společnosti Pfizer.

Váš organismus funguje v souladu s programem vaší DNA, a nyní, no, program byl nabourán a upraven společností Pfizer.

Kód rakoviny

Vzhledem k tomu, že Sars-Cov-2 „spike protein” má rakovinový kód z patentu společnosti Moderna z roku 2017 s číslem 9,587,003, je nezbytné zjistit, jaké důsledky má tento zpětný přepis a zda očkovaní nyní nemají ve své DNA zabudovaný nějaký nežádoucí genetický kód.

Zvláště zajímavé je, zda tato reverzní transkripce vyvolaná mRNA ovlivňuje „zárodečnou linii”, jako jsou vajíčka a spermie, a zda ovlivňuje také plod těhotných matek.

Prosím, přeposílejte tento článek dál a dál, protože má velký význam pro naše veřejné zdraví.

EDIT: Náš bystrý komentátor upozornil na anonymní příspěvek na 4chanu z prosince 2020, tedy dlouho předtím, než se o tom začalo vědět. Datum nás všechny nutí se ptát, zda toho ten člověk věděl příliš mnoho?

Překlad obrázku:

Jsem průmyslový inženýr ve společnosti Moderna a druhý z nás je inženýr pro vývoj procesů. Jsem si jistý, že totéž se děje i ve společnosti Pfizer-BioNTech. Bylo těžké dát věci dohromady na základě malého množství přídavků probíhajících v manuálním kroku (velmi nestandardní pro kontinuální proces výroby). Vysvětlení, které jsme dostali, bylo, že se přidávají vysoce citlivé adjuvanty, které jsou obchodním tajemstvím. Při hlubším pátrání se ukázalo, jak citlivé to ve skutečnosti bylo.

Většina lidí tento nový typ vakcíny chápe tak, že funguje následovně:

1. Vytvořte mRNA kódující protein S

2. Vytvořte lipidový nanočásticový nosič.

3. Zisk

Jak to vlastně funguje z toho, co jsme odhalili:

1. Vytvořte mRNA kódující protein S

2. Vytvořte mRNA kódující mutantní verze CYP19A1 a CDKN1B v menším množství.

3. Ujistěte se, že zatímco doručovací systém pro (1) končí většinou v játrech, většina (2) končí v gonádách.

4. Ujistěte se, že forma a množství přídatné látky zvyšující aktivitu reverzní transkripce LINE-1 ztěžuje její detekci mezi regulérními adjuvanty.

5. Účinky (2) integrované (4) jsou recesivní; mírně onkogenní účinky u příjemců vakcíny pravděpodobně nebudou zaznamenány po mnoho let.

6. (5) recesivní, ale protože většina populace je očkována, v další generaci dochází u potomků ženského pohlaví k předčasnému selhání vaječníků.

(6) se shoduje s tím, že chudí lidé jsou posedlí UI (umělou inteligencí) a robotikou, takže jsme nemuseli pátrat po motivaci.

Přijali jsme preventivní opatření, ale obáváme se o svou bezpečnost. Zatím si nemyslím, že bychom vzbudili podezření, ale jistotu mít nemůžeme. Nejsme si jisti, co dělat. Tím, že se vyhýbáme očkování, z nás dělá hlavní podezřelé z tohoto úniku.

DNA přepsaná z mRNA vakcíny Pfizer obsahuje mutantní nádorový gen gp130: tu

Můj předchozí příspěvek o vědeckém článku dokazujícím, že vakcína Pfizer mRNA se zpětně přepisuje do lidské DNA, vzbudil obrovský zájem a spoustu komentářů, z nichž některé byly neuvěřitelné.

Pokud jste ho ještě nečetli, PŘEČTĚTE SI HO PROSÍM PRVNÍ, než si přečtete toto navazující pokračování. Jinak se můžete ztratit a ani si neuvědomit význam toho, jak mohl být přeprogramován genetický kód vašich blízkých.

Rozhodl jsem se pokračovat v práci a zjistit, co dalšího můžeme objevit na základě článku “Current Issues in Molecular Biology“:

Článek obsahuje výtisk genetického kódu DNA, který byl zjištěn v materiálech DNA lidských buněk reverzně přepsaných z mRNA vakcíny.

Tak jsem se rozhodl zkontrolovat, co je vlastně v tomto kódu výše, zda je to jen neškodné smetí, nebo něco zlověstnějšího. Za tímto účelem jsem spustil bezplatný nástroj NCBI “BLAST” tak, že jsem do něj zkopíroval a vložil výše uvedenou genetickou sekvenci. Jedná se o stejný nástroj BLAST, který použil @JikkyKjj, aby ukázal sekvenci „patentu na rakovinu” od Moderny na nejdůležitější, „furinové štěpné místo” Sars-Cov-2.

Každopádně jsem se pod dojmem objevu @JikkyKjj rozhodl udělat totéž s DNA kódem, který vakcína Pfizer mRNA generuje (reverzně přepisuje) do lidských buněk. Ukázalo se, že jsem jako první zadal tuto sekvenci do nástroje NCBI BLAST (protože její analýza chvíli trvala) a nyní má sekvenční ID 1R3ZDZJY016.

A tady jsou výsledky. Opatřil jsem je poznámkami, abyste snáze viděli, co je a co není zajímavé.

Prvních několik výsledků pochází od obvyklých podezřelých, jako jsou chimérické viry, sekvence Sars-Cov-2 atd. Je pochopitelné, proč bychom je měli ignorovat – chimérické viry jsou čistě laboratorní konstrukty neznámého významu a sekvence Sars-Cov-2 jsou tam zřejmě proto, že vakcína kóduje protein Sars-Cov-2 spike. To jsou „očekávané shody”.

Co je zajímavé – a netvrdím, že je to jediná věc – je gen pro glykoprotein gp130, který je z 97 % podobný lidskému genu pro glykoprotein gp130. Šance, že se jedná o náhodnou shodu, je podle nástroje BLAST 0,000000000000000000000000000000000000000000000000000000000000000000000002 %

Kliknul jsem na něj:

Kliknutím na odkaz „Gen” se dozvíte, co je to gen gp130:

Máme tedy mRNA covid vakcínu od Pfizeru, která se reverzně přepisuje do MUTOVANÉHO genu gp130. Vzpomínáte si na 97% shodu? Ta 3% neshoda, čtyři červené tečky, jsou mutace genu gp130.

Aniž bychom se tedy zabývali těmito konkrétními mutacemi, co se stane, když gen gp130 zmutuje obecně? Nic dobrého se neobjeví a můžete si to také vyhledat.

Upozorňujeme, že vyvstává otázka: mutace gp130 mohou způsobit nádor jater a celý experiment byl proveden na linii nesmrtelných buněk rakoviny jater. Je možné, že původní článek zachytil mutovanou gp130 z buněk rakoviny jater Huh7? Pokud je tomu tak a sekvence DNA je vlastní samotné linii Huh7, mohlo by to zneplatnit mnoho závěrů, které původní vědecký článek i mé vlastní články dělaly.

Autoři však pečlivě prováděli kontroly a u kontrolních buněk, které NEOBSAHOVALY vakcínu společnosti Pfizer, NEVIDĚLI zpochybňovanou sekvenci DNA, na kterou se dívám já. Kromě toho publikovaná sekvence DNA obsahovala geny Sars-Cov-2 (viz výsledky BLAST), takže skutečně pochází z účinku vakcíny, nikoli z buněk kultury Huh7.

Provedl jsem zběžnou kontrolu podle svých možností a linie Huh7 obsahuje mutace p53, ale nezdá se, že by obsahovala mutace gp130.

Takže držím palce, aby mutovaný gen gp130, který jsem našel, byl skutečným nálezem laboratorního výzkumu, pocházel z mRNA vakcíny, a ne náhodným vyzvednutím z buněk Huh7.

Předpokládám, že autoři zkoumali konkrétně jaterní buňky, protože věděli, kde hledat (že systém doručení mRNA dopraví lipidové nanočástice do jater). Proč si autoři vybrali právě jaterní buňky? Možná proto, že se dozvěděli o tomto příspěvku na 4chanu z roku 2020, kdy se o podivných mRNA vakcínách ještě NIC nevědělo:

Překlad obrázku:

Jsem průmyslový inženýr ve společnosti Moderna a druhý z nás je inženýr pro vývoj procesů. Jsem si jistý, že totéž se děje i ve společnosti Pfizer-BioNTech. Bylo těžké dát věci dohromady na základě malého množství přídavků probíhajících v manuálním kroku (velmi nestandardní pro kontinuální proces výroby). Vysvětlení, které jsme dostali, bylo, že se přidávají vysoce citlivé adjuvanty, které jsou obchodním tajemstvím. Při hlubším pátrání se ukázalo, jak citlivé to ve skutečnosti bylo.

Většina lidí tento nový typ vakcíny chápe tak, že funguje následovně:

1. Vytvořte mRNA kódující protein S

2. Vytvořte lipidový nanočásticový nosič.

3. Zisk

Jak to vlastně funguje z toho, co jsme odhalili:

1. Vytvořte mRNA kódující protein S

2. Vytvořte mRNA kódující mutantní verze CYP19A1 a CDKN1B v menším množství.

3. Ujistěte se, že zatímco doručovací systém pro (1) končí většinou v játrech, většina (2) končí v gonádách.

4. Ujistěte se, že forma a množství přídatné látky zvyšující aktivitu reverzní transkripce LINE-1 ztěžuje její detekci mezi regulérními adjuvanty.

5. Účinky (2) integrované (4) jsou recesivní; mírně onkogenní účinky u příjemců vakcíny pravděpodobně nebudou zaznamenány po mnoho let.

6. (5) recesivní, ale protože většina populace je očkována, v další generaci dochází u potomků ženského pohlaví k předčasnému selhání vaječníků.

(6) se shoduje s tím, že chudí lidé jsou posedlí UI (umělou inteligencí) a robotikou, takže jsme nemuseli pátrat po motivaci.

Přijali jsme preventivní opatření, ale obáváme se o svou bezpečnost. Zatím si nemyslím, že bychom vzbudili podezření, ale jistotu mít nemůžeme. Nejsme si jisti, co dělat. Tím, že se vyhýbáme očkování, z nás dělá hlavní podezřelé z tohoto úniku.

Bylo nám řečeno, že se to nikdy nestane

Objasnění 

Sekvence mutovaných genů gp130, nalezená v DNA reverzně přepsané z vakcíny Pfizer Covid,

  • neznamená, že NUTNĚ způsobí rakovinu.
  • Čtyři uvedené mutace „červené tečky” mohou být neškodné
  • Neznamená, že byly do vakcíny společnosti Pfizer přidány záměrně, aby způsobily poškození.
  • Neznamená, že je dokonce exprimován jako protein gp130, protože exprese genů závisí na buněčném kontextu.
  • Znamená to však, že se na to musíme podívat zblízka.

Prosím, přeposílejte tento článek v naději, že ho uvidí někdo důležitý a úřady se začnou zajímat o „neočekávané” účinky covid mRNA vakcín mRNA. Naše děti ji dostávají injekčně a zasloužíme si vědět, co to s nimi dělá!

Tvrzení o genetickém poškození novorozených holčiček lze snadno ověřit: tu

Nedávno jsem napsal několik článků o studii, která zjistila reverzní přepis mRNA do DNA v lidských buňkách.

Proč je to důležité? Když začala kampaň očkování mRNA, bylo nám slíbeno, že mRNA uzavřená v lipidových nanočásticích (LNP) má velmi krátkou životnost, vytváří „neškodný spike protein” a za několik dní zmizí, čímž připraví náš imunitní systém na úspěch. Virus, jak nám bylo řečeno, „přestane s každým očkovaným člověkem”.

Nyní víme, že nic z toho, co nám bylo slibováno, nebyla pravda: spike protein není neškodný, mRNA z vakcíny je nepřirozeně stabilizovaná a zůstává aktivní po celé měsíce, a samozřejmě víme, jak dobře vakcína funguje. A co je nejhorší, dozvěděli jsme se, že mRNA vakcíny se v lidských buňkách mění na DNA.

Od doby, kdy jsem tyto články zveřejnil, však vyšly najevo mnohem znepokojivější informace. Týkají se „modifikací zárodečné linie”, tedy modifikací ženských vajíček a mužských spermií, které by mohly v příští generaci způsobit neplodnost žen.

Znepokojivá tvrzení

Jeden bystrý čtenář upozornil na archivní kopii anonymního příspěvku z roku 2020, tedy z doby předtím, než se o jakýchkoli problémech s vakcínami začalo vědět. Tento anonymní, nepodepsaný příspěvek na serveru 4chan údajně napsali procesní inženýr společnosti Moderna a průmyslový inženýr společnosti Moderna.

Překlad obrázku:

Jsem průmyslový inženýr ve společnosti Moderna a druhý z nás je inženýr pro vývoj procesů. Jsem si jistý, že totéž se děje i ve společnosti Pfizer-BioNTech. Bylo těžké dát věci dohromady na základě malého množství přídavků probíhajících v manuálním kroku (velmi nestandardní pro kontinuální proces výroby). Vysvětlení, které jsme dostali, bylo, že se přidávají vysoce citlivé adjuvanty, které jsou obchodním tajemstvím. Při hlubším pátrání se ukázalo, jak citlivé to ve skutečnosti bylo.

Většina lidí tento nový typ vakcíny chápe tak, že funguje následovně:

1. Vytvořte mRNA kódující protein S

2. Vytvořte lipidový nanočásticový nosič.

3. Zisk

Jak to vlastně funguje z toho, co jsme odhalili:

1. Vytvořte mRNA kódující protein S

2. Vytvořte mRNA kódující mutantní verze CYP19A1 a CDKN1B v menším množství.

3. Ujistěte se, že zatímco doručovací systém pro (1) končí většinou v játrech, většina (2) končí v gonádách.

4. Ujistěte se, že forma a množství přídatné látky zvyšující aktivitu reverzní transkripce LINE-1 ztěžuje její detekci mezi regulérními adjuvanty.

5. Účinky (2) integrované (4) jsou recesivní; mírně onkogenní účinky u příjemců vakcíny pravděpodobně nebudou zaznamenány po mnoho let.

6. (5) recesivní, ale protože většina populace je očkována, v další generaci dochází u potomků ženského pohlaví k předčasnému selhání vaječníků.

(6) se shoduje s tím, že chudí lidé jsou posedlí UI (umělou inteligencí) a robotikou, takže jsme nemuseli pátrat po motivaci.

Přijali jsme preventivní opatření, ale obáváme se o svou bezpečnost. Zatím si nemyslím, že bychom vzbudili podezření, ale jistotu mít nemůžeme. Nejsme si jisti, co dělat. Tím, že se vyhýbáme očkování, z nás dělá hlavní podezřelé z tohoto úniku.

Za normálních okolností by si taková anonymní obvinění nezasloužila žádnou pozornost, s výjimkou

  • Tohle bylo vlastně dobře napsáno s použitím správného obchodního žargonu
  • Bylo to napsáno v roce 2020 PŘEDtím, než se začalo cokoli vědět o nebezpečnosti mRNA vakcín, a použité termíny nebyly v kurzu
  • Mnohá tvrzení tohoto příspěvku se skutečně ověřují. Konkrétně LINE-1 reverzní transkriptáza interaguje s vakcínami a reverzní transkripce DNA skutečně převádí mRNA na DNA v lidských buňkách.
  • Tyto věci je velmi těžké vymyslet bez znalosti věci.

Největším tvrzením je, že záměrně mutovaná verze genu CDKN1B končí v gonádách (vaječnících a varlatech). Kromě toho anonymní příspěvek tvrdí, že náklad mRNA by modifikoval lidskou DNA buněk produkujících vajíčka i spermie a vnesl by do ní mutaci CDKN1B. Podle tohoto neověřeného příspěvku bez uvedení zdroje je tato mutace recesivní, což znamená, že by se projevila pouze tehdy, pokud by OBĚ rodičovské pohlavní buňky – vajíčko a konkrétní spermie, která ji oplodní – nesly CDKN1B.

Možným důsledkem této údajné mutace je, že potomci očkovaných osob ženského pohlaví by byli náchylní k „předčasnému selhání vaječníků”, a tudíž by nebyli schopni reprodukce.

Tento typ anonymních materiálů by měl být obvykle odmítnut jako divoká fantazie, AŽ NA TO, ŽE CO PROZATÍM VÍME, POTVRZUJE TO, CO SE V NĚM PÍŠE, a bylo to napsáno dříve, než se široká veřejnost mohla dozvědět jakákoli tato fakta nebo problémy, takže dává smysl, že to napsali zasvěcení lidé, a nejedná se o spekulace nezasvěcených.

Podle mého názoru si tedy tento příspěvek zaslouží další skeptickou, ale pozornou pozornost.

Jak to ověřit nebo (snad) vyvrátit

Je velmi obtížné ověřit v laboratoři, jaké procesy přesně probíhají „in vivo”, uvnitř vaječníků a varlat. Měření takových procesů v reprodukčních orgánech je náchylné k chybám, molekulární složitosti, složitým etickým otázkám a pravděpodobně bude velmi časově náročné a nákladné na řádné studium.

Výsledek toho všeho je však velmi snadné otestovat: stačí najít několik desítek novorozených holčiček, které se narodily rodičům dvakrát očkovaným nejméně měsíc před početím. Pak by jim vědci mohli provést stěr DNA z tváří a ověřit, zda tyto holčičky nesou údajnou mutaci CDKN1B.

Taková studie by nebyla invazivní, přinesla by (snad) rodičům potěšující zprávu a byla by levná.

Když se podíváme na časovou osu, dítě narozené v březnu 2022 by bylo počato přibližně v červnu loňského roku, takže každý pár, kde byli oba manželé očkováni před loňským květnem, by splňoval podmínky. Taková miminka není vůbec těžké najít a mělo by to být velmi snadné provést. Nejedná se o žádné invazivní zákroky a novorozenci nehrozí žádné nebezpečí.

Doufám a modlím se, aby odpověď byla negativní a holčičky nebyly nositelkami mutace CDKN1B. Ale nějaké ujištění bychom určitě uvítali.

Sperma

Dalším velmi snadným pokusem je otestovat sperma očkovaných mužů, zda nevykazuje zvýšenou hladinu nějaké specifické mutace ve srovnání s minulostí.

Překlad obrázku:

Sekvenční analýza genu CDKN1B u pacientek s předčasným
selháním vaječníků odhalila novou mutaci
potenciálně související s fenotypem.

Předčasné selhání vaječníků.

Články publikovány ZDE: 25-28. února 2022

David Formánek

Zdroj: otevrisvoumysl.cz

By Archa21